DNA Alignment in Clustal Format

This is a non-interleaved format.
NOTE the dashes in the sequence. They were introduced during the alignment
process. Scroll down and you will see the other files.

-------------------------------------------------------------------------

CLUSTAL W (1.8) multiple sequence alignment (BioEdit-generated mock-up)

BaCMV__OCOM4-37_ ATGAAGGTAACAGTACATGTCAATTCACGTTTTGGGAAAAGTCTGACCGC
BaCMV__OCOM4-52_ ATGAAGGTAACAGTACATGTCAATTCACTTTCTGGGAAAAGTCGGAACGC
DrCMV___OCOM6-2_ GTGAAAGCGACAGTACATGTCAATTCACTTTGTGGGAAACGTCGGAACGC
RhCMV____U59238_ AGGAAGCTAATAATACCTGTGAATACACGTTTTGGGAACAATCAGAACGC
RhCMV____U76749_ AGGAAGCTAATAATACCTGTGAATACACGTTTTGGGAACAATCAGAACGC
HCMV______AD169_ ACGAGAAGAATGTCACCTGCCAGCTCACCTTCTGGGAAGCCTCGGAACGT

BaCMV__OCOM4-37_ ACTATTCGCTCTGAAGCTGAGGATACCTACCATTTTACTTCTAACAGTAT
BaCMV__OCOM4-52_ ACCATTCGCTCTGAAGCTGATGATACTTACCATTTCACTTCTAACAGCAT
DrCMV___OCOM6-2_ ACCATTCGCTCTGAAGCTGAGGAAAGCTATCATTTCACTTCTAATAGCAT
RhCMV____U59238_ ACAATTAGATCGGAGGCTGATGATACCTATCATTATACATCTAGCAGTAT
RhCMV____U76749_ ACAATTAGATCGGAGGCTGATGATACCTATCATTATACATCTAGCAGTAT
HCMV______AD169_ ACTATCCGTTCCGAAGCCGAAGACTCGTACCACTTTTCTTCTGCCAAAAT

BaCMV__OCOM4-37_ GACGGCAACTTTTTTGACAAAAAAAACACCGGTGAACGATTCGGATCCTG
BaCMV__OCOM4-52_ GACGGCAACTTTTTTAACAAAGAAGGATCCCGTAAATGATTCAGATTCTG
DrCMV___OCOM6-2_ GACTGCGACTTTCTTGGCAAAAAAGACGCCGGTGAACGATTCTGATCCTG
RhCMV____U59238_ GACGGCCACCTTTTTAACTTCAAAAGAGGAACTAAATGAGTCTGATCCTT
RhCMV____U76749_ GACGGCCACCTTTTTAACTTCAAAAGAGGAACTAAATGAGTCTGATCCTT
HCMV______AD169_ GACTGCAACTTTTCTGTCTAAGAAACAAGAAGTGAACATGTCCGACTCCG

BaCMV__OCOM4-37_ CCCTAAATTGCATTAAAGAACAGGCTGAAAAGAAGATTGAAGAAATTTTT
BaCMV__OCOM4-52_ CTTTGGATTGCATTAAACAACAGGCTGAAAATAAAATTGAGGAAATTTTT
DrCMV___OCOM6-2_ CTCTAGAGTGCATCAAAAAACAGGCTGAAGAGAAGATCGATGAGATTTTT
RhCMV____U59238_ CTTTTCAATGTATTAAGGATAAAGCTAATGAGCAGTTACAACTAATTTTT
RhCMV____U76749_ CTTTTCAATGTATTAAGGATAAAGCTAATGAGCAGTTACAACTAATTTTT
HCMV______AD169_ CGCTGGACTGCGTACGTGATGAGGCTATAAATAAGTTACAGCAGATTTTC

BaCMV__OCOM4-37_ AATACCACATATAATTCTACATATGTAAAAGCAGGCAATGTAACTATCTA
BaCMV__OCOM4-52_ AACGCTACATATAATTCTACATATGTAAAAGCAGGCAATGTAACTATCTA
DrCMV___OCOM6-2_ AACAACACATACAATTATACATATGAAAAATCGGACAACGTAACTATTTA
RhCMV____U59238_ AATACATCTTATAACGAGACATATGTACAATCTGGAAATGTTTCTATGTA
RhCMV____U76749_ AATACATCTTATAACGAGACATATGTACAATCTGGAAATGTTTCTATGTA
HCMV______AD169_ AATACTTCATACAATCAAACATATGAAAAATACGGAAACGTGTCCGTCTT

BaCMV__OCOM4-37_ TGAAACAACTGGTGGATTGATTGTATTTTGGCTACCAGTAAAAGAAAAAT
BaCMV__OCOM4-52_ TGAAACAACTGGTGGATTGATTGTATTTTGGCTACCAGTAAAAGAAAAAT
DrCMV___OCOM6-2_ TGAAACAACTGGTGGATTGATTGTGTTTTGGTTGCCGGTCAAAGAAAGAT
RhCMV____U59238_ TGAAACCACTGGTGGATTGATTGTGTTTTGGTTACCTGTAAAAGAAAAAT
RhCMV____U76749_ TGAAACCACTGGTGGATTGATTGTGTTTTGGTTACCTGTAAAAGAAAAAT
HCMV______AD169_ CGAAACCAGCGGCGGTCTGGTGGTGTTCTGGCAAGGCATCAAGCAAAAAT

BaCMV__OCOM4-37_ CAATTTGGGACATGAAAAAACTTGCTGATGGATACG---CAAACATAACA
BaCMV__OCOM4-52_ CAATTTGGGACATGAAAAAACTTGCCGATGGATACG---CAAACATGACA
DrCMV___OCOM6-2_ CCCTTTTGGAAATGAAGCAACTGGCCGATGGATACG---CAAATATGACC
RhCMV____U59238_ CGATTCTTGAGATGGAGGAATTGGCTGTAGCTTACA---ACAATACCAAC
RhCMV____U76749_ CGATTCTTGAGATGGAGGAATTGGCTGTAGCTTACA---ACAATACCAAC
HCMV______AD169_ CTTTGGTGGAATTGGAACGTTTGGCCAATCGATCCAGTCTGAATATCACT

BaCMV__OCOM4-37_ AATGCTACTACATCCTCACGTACTAAGCGATCTACAGACGACAGTACATT
BaCMV__OCOM4-52_ AACGCTAGTACATCCTCACGTACTAAGCGATCTACAAGTGACAGTACATT
DrCMV___OCOM6-2_ AGCACG---------TCACGTAAAAAACGCTCTACAGACAACAGTGAAGT
RhCMV____U59238_ AGTAGTA---------CTCGTAGAAAACGTTCTACTGATTCCGCATCGGA
RhCMV____U76749_ AGTAGTA---------CTCGTAGAAAACGTTCTACTGATTCCGCATCGGA
HCMV______AD169_ CATAGGA--------CCAGAAGAAGTACGAGTGACA-ATAATACAACTCA

BaCMV__OCOM4-37_ ATTGAACAATACT------GAAGTAATACATAACATTGTGTATGCGCAAT
BaCMV__OCOM4-52_ ATTGAACAATACT------GAAGTAATACACAACATTGTGTATGCGCAAT
DrCMV___OCOM6-2_ GTTAAACAGTAC---------GGTGGTGCATAGTATTGTGTATGCGCAAC
RhCMV____U59238_ CTCTAACAAAACCTCAGAAGAAGTTCTAAAAAGCATAGTGTATGCTCAAT
RhCMV____U76749_ CTCTAACAAAACCTCAGAAGAAGTTCTAAAAAGCATAGTGTATGCTCAAT
HCMV______AD169_ TTTGTCCAGCATG------GAATCGGTGCACAATCTGGTCTACGCCCAGC

BaCMV__OCOM4-37_ TGCAGTTCACTTATGACACTTTGAGAAACTACATTAACCGTGCTCTGAGA
BaCMV__OCOM4-52_ TGCAGTTCACTTATGATACCTTGAGAAATTACATTAACCGCGCTCTGAGA
DrCMV___OCOM6-2_ TACAGTTTACTTACGACACTTTAAGGAATTATATTAACCGCGCTCTCAGA
RhCMV____U59238_ TGCAGTACATTTATGATACATTGAGAAATTACATTAACCGTGCTCTCAGG
RhCMV____U76749_ TGCAGTACACTTATGATACATTGAGAAATTACATTAACCGTGCTCTCAGG
HCMV______AD169_ TGCAGTTCACCTATGACACGTTGCGCGGTTACATCAACCGGGCGCTGGCG

BaCMV__OCOM4-37_ CAGATCGCTGAAGCCTGGTGTAAAGACCAAAAAAGAACACTCGAAGTCCT
BaCMV__OCOM4-52_ CAAATTGCTGAAGCCTGGTGTAAAGATCAAAGAAGAACACTTGAAGTCCT
DrCMV___OCOM6-2_ CAGATCGCTGAAGCCTGGTGTAAAGATCAAAGAAGAACACTGGAAGTCCT
RhCMV____U59238_ CAAATCGCTGAAGCATGGTGTAAAGATCAGAAGAGAACATTGGAAGTGTT
RhCMV____U76749_ CAAATCGCTGAAGCATGGTGTAAAGATCAGAAGAGAACATTGGAAGTGTT
HCMV______AD169_ CAAATCGCAGAAGCCTGGTGTGTGGATCAACGGCGCACCCTAGAGGTCTT

BaCMV__OCOM4-37_ GAAAGAACTCAGTAAAATAAATCCTACTGCCATGTTGTCTGCCATCTACG
BaCMV__OCOM4-52_ TAAGGAACTGAGCAAAATCAATCCTACTGCTATGTTGTCTGCCATCTATG
DrCMV___OCOM6-2_ CAAAGAACTCAGTAAAATAAATCCCACTGCCATGCTGTCCGCCATTTATG
RhCMV____U59238_ CAAAGAACTCAGCAAAATCAATCCCAGTGCTATGCTGTCTGCCATTTACG
RhCMV____U76749_ CAAAGAACTCAGCAAAATCAATCCCAGTGCTATGCTGTCTGCCATTTACG
HCMV______AD169_ CAAGGAACTCAGCAAGATCAACCCGTCAGCCATTCTCTCGGCCATTTACA

BaCMV__OCOM4-37_ ATAAGCCAGTTGCTGCTCGATATGCTGGAGATGTTATAAGCTTAGCTAAG
BaCMV__OCOM4-52_ ATAAACCAGTTGCTGCTCGATATGCTGGAGACGTTATAAGCTTAGCTAAG
DrCMV___OCOM6-2_ ACAGACCAGTTGCTGCCCGATATGCGGGGGATGTTATAAGCTTAGCTAAG
RhCMV____U59238_ ATAAACCGATTGCCGCTCGGTTTGTTGGAGATGTTATCAGTCTTGCTAAG
RhCMV____U76749_ ATAAACCGATTGCCGCTCGATTTGTTGGAGATGTTATCAGTCTTGCTAAG
HCMV______AD169_ ACAAACCGATTGCCGCGCGTTTCATGGGTGATGTCTTGGGCCTGGCCAGC

BaCMV__OCOM4-37_ TGTGTTGAAGTTAACCAAACTACAGTTCAAGTGATGCGTGACATGCATGT
BaCMV__OCOM4-52_ TGTGTTGAAGTTAACCAAACTACAGTTCAAGTGCTCCGTGACATGCATGT
DrCMV___OCOM6-2_ TGTGTGGAAGTCAACCAGACCACGGTTCAAGTGTTGCGTGACATGCATGT
RhCMV____U59238_ TGTGTGGAGGTGGATCAGAACAGTGTCAAAGTGCTACGTGATATGCGTAC
RhCMV____U76749_ TGTGTGGAGGTGGATCAGAACAGTGTCAAAGTGCTACGTGATATGCGTAC
HCMV______AD169_ TGCGTGACCATCAACCAAACCAGCGTCAAGGTGCTGCGTGATATGAACGT

BaCMV__OCOM4-37_ GAAAGGTGAAAGCAATCTATGTTATTCTAGGCCTGTGGTGTTGTACAGAT
BaCMV__OCOM4-52_ AAAGGATGACCGTGAACTTTGTTATTCTCGGCCTGTGGTGTTGTACAGAT
DrCMV___OCOM6-2_ GAAAGATAAAAGCGATCTTTGCTATTCTCGACCTGTGGTGTTGTACAGAT
RhCMV____U59238_ AAAGG---AATCTGGTGTTTGCTATTCTCGGCCGGTTGTGCTGTACACTT
RhCMV____U76749_ AAAGG---AATCTGGTGTTTGCTATTCTCGGCCGGTTGTGCTGTACACTT
HCMV______AD169_ GAAGGAATCGCCAGGACGCTGCTACTCACGACCCGTGGTCATCTTTAATT

BaCMV__OCOM4-37_ TTTACAATAGTTCGCATGTTCAGTATGGTCAGCTGGGAGAAAACAACGAA
BaCMV__OCOM4-52_ TTTACAACAGTTCGCATGTTCAGTATGGCCAGCTGGGAGAGAACAACGAA
DrCMV___OCOM6-2_ TCTACAACAGTTCGCATGTTCAGTACGGGCAACTGGGCGAAAATAACGAA
RhCMV____U59238_ TTAAAAACAGTTCTCATGTCCAGTATGGCCAGCTTGGTGAATATAATGAA
RhCMV____U76749_ TTAAAAACAGTTCTCATGTCCAGTATGGCCAGCTTGGTGAATATAATGAA
HCMV______AD169_ TCGCCAACAGCTCGTACGTGCAGTACGGTCAACTGGGCGAGGACAACGAA

BaCMV__OCOM4-37_ ATTCTGTTGGGGCGTCATCGTACTGAAGCGTGTGAAACTCCCAGCGTGAA
BaCMV__OCOM4-52_ ATTTTGTTGGGACGTCATCGTACTGAAGCATGCGAAATTCCCAGCGTGAA
DrCMV___OCOM6-2_ ATTTTGCTGGGACGTCACCGTACTGAATCATGTGAAATCCCTAGCGTAAA
RhCMV____U59238_ ATTTTGCTTGGACGCCATCGTACAGAGGCGTGTGAATACCCCAGTTTGAA
RhCMV____U76749_ ATTTTGCTTGGACGCCATCGTACAGAGGCGTGTGAATACCCCAGTTTGAA
HCMV______AD169_ ATCCTGTTGGGCAACCACCGCACTGAGGAATGTCAGCTTCCCAGCCTCAA

BaCMV__OCOM4-37_ AATTTTTATTGCTGGTAACACTTCGTACGAATATGTGGACTATCTGTTCA
BaCMV__OCOM4-52_ AATTTTTATTGCTGGCAACACTTCGTACGAATATGTGAATTATCTGTTTA
DrCMV___OCOM6-2_ AATTTTTATTGCCGGCAACACTTCGTATGAATATGTGGACTATGTGTTCA
RhCMV____U59238_ AATTTATATTGCTGGTAATTCGTCTTACGAATATGTTGACTATCTGTACA
RhCMV____U76749_ AATTTATATTGCTGGTAATTCGTCTTACGAATATGTTGACTATCTGTACA
HCMV______AD169_ GATCTTCATCGCCGGGAACTCGGCCTACGAGTACGTGGACTACCTCTTCA

BaCMV__OCOM4-37_ AGAGAGAAGTTCCCCTGGATAGTATTCCAGTGGTAGAAACCATGATTTCC
BaCMV__OCOM4-52_ AGAGAGAAGTTTCCTTGGGTAGTATTCCAGTGGTGGAAACCATGATTTCC
DrCMV___OCOM6-2_ GGAGAGAACTTTCTTTGGACAGCATTCCGGTGGTGGAAACTATGATTTCC
RhCMV____U59238_ AAAGAATGATTCCACTGGACAGCATTTCCACCGTAGACACCATGATTTCT
RhCMV____U76749_ AAAGAATGATTCCACTGGACAGCATTTCCACCGTAGACACCATGATTTCT
HCMV______AD169_ AACGCATGATTGACCTCAGCAGTATCTCCACCGTCGACAGCATGATCGCC

BaCMV__OCOM4-37_ TTGGATATCGACCCTTTGGAAAACACAGATTTCAAAGCTTTGGAACTGTA
BaCMV__OCOM4-52_ CTGGATATTGATCCCTTGGAAAACACAGACTTTAAAGCTTTGGAACTGTA
DrCMV___OCOM6-2_ CTGGACATTGACCCGTTGGAGAACACGGACTTTAAAGCTTTGGAACTGTA
RhCMV____U59238_ CTGGACATTGATCCGCTGGAAAACACCGATTTCAAAGCTTTGGAACTGTA
RhCMV____U76749_ CTGGACATTGATCCGCTGGAAAACACCGATTTCAAAGCTTTGGAACTGTA
HCMV______AD169_ CTGGATATCGACCCGCTGGAAAATACCGACTTCAGGGTACTGGAACTTTA

BaCMV__OCOM4-37_ CTCCGAGGATGAACTGCGTGCCAGCAATGTTTTCAATCTGGAAGAGATTA
BaCMV__OCOM4-52_ CTCCGAGGATGAACTGCGTGCCAGCAACGTTTTCAATCTGGAGGAGATTA
DrCMV___OCOM6-2_ CTCTGAGGAAGAACTGCGTGCCAGCAACGTTTTCAATCTGGAGGAAATAA
RhCMV____U59238_ CTCTGAGGACGAATTACGGTCTAGTAATGTGTTTGATTTGGAAGACATCA
RhCMV____U76749_ CTCTGAGGACGAATTACGGTCTAGTAATGTGTTTGATTTGGAAGACATCA
HCMV______AD169_ CTCGCAGAAAGAGCTGCGTTCCAGCAACGTTTTTGACCTCGAAGAGATCA

BaCMV__OCOM4-37_ TGCAAGAGTTCAACGCTTACAAGCAACGGGTCGTTCACGTGGAAGGAAAG
BaCMV__OCOM4-52_ TGCAAGAGTTCAACGCTTACAAGCAACGGGTCGTTCACGTGGAAGGAAAG
DrCMV___OCOM6-2_ TGCAAGAGTTTAACGCTTACAAGCAGCGGGTCGTTCACGTGGAAGGAAAG
RhCMV____U59238_ TGCGAGAGTTCAATACGTACAAGCAGAGAATGATTCACGTGGAAGGAAAG
RhCMV____U76749_ TGCGAGAGTTCAATACGTACAAGCAGAGAATGATTCACGTGGAAGGAAAG
HCMV______AD169_ TGCGCGAATTCAACTCGTACAAGCAGCGGGTAAAGTACGTGGAGGACAAG

BaCMV__OCOM4-37_ GTGTTCGACACCGTCCCTACATATCTCAGGGGCCTGGACGACTTGATGAG
BaCMV__OCOM4-52_ GTGTTCGACACCGTTCCTACATATCTCAGGGGCCTGGACGACTTGATGAG
DrCMV___OCOM6-2_ GTGTTCGACACCGTCCCAGCATATCTCAGAGGCCTGGACGATTTGATGAG
RhCMV____U59238_ GTGTTCGACAAAGTGCCTGGATATCTTCGTGGTCTGGATGATATGATGAG
RhCMV____U76749_ GTGTTCGACAAAGTGCCTGGATATCTTCGTGGTCTGGATGATATGATGAG
HCMV______AD169_ GTAGTCGACCCGCTACCGCCCTACCTCAAGGGTCTGGACGACCTCATGAG

BaCMV__OCOM4-37_ CGGTCTTGGTGCAGCGGGCAAAGCTTTGGGTGTGGCCATCGGAGCCGTTG
BaCMV__OCOM4-52_ CGGTCTTGGTGTAGCGGGCAAAGCTTTGGGTGTGGCCATCGGAGCCGTTG
DrCMV___OCOM6-2_ TGGTCTCGGTGTAGCGGGAAAAGCTTTGGGTGTGGCCATCGGGGCTGTTG
RhCMV____U59238_ CGGTCTAGGTTCTGCAGGGAAGGCTTTGGGTGTGGCCATCGGAGCTGTCG
RhCMV__U__76749_ CGGTCTAGGTTCTGCAGGGAAGGCTTTGGGTGTGGCCATCGGAGCTGTCG
HCMV__AD____169_ CGGCCTGGGCGCCGCGGGAAAGGCCGTTGGCGTAGCCATTGGGGCCGTGG

BaCMV__OCOM4-37_ GCGGTGCCGTGGCTTCCTTTGTGGAGGGCATTGTTGGTTTCATCAAAAAC
BaCMV__OCOM4-52_ GCGGTGCCGTGGCTTCCTTTGTGGAGGGCATCGTTGGTTTCATCAAAAAC
DrCMV___OCOM6-2_ GCGGTGCTGTAGCTTCTTTCGTAGAGGGTATTGTTGGTTTCATCAAAAAC
RhCMV____U59238_ GTGGTGCTGTGGCTTCTTTTGTGGAAGGTGTCGTCGGTTTCATCAAGAAT
RhCMV____U76749_ GTGGTGCTGTGGCTTCTTTTGTGGAAGGTGTCGTCGGTTTCATCAAGAAT
HCMV______AD169_ GTGGCGCGGTGGCCTCCGTGGTCGAAGGCGTTGCCACCTTCCTCAAAAAC

BaCMV__OCOM4-37_ CCGTTTGGTTCTTTAACTGTCATACTCTTT
BaCMV__OCOM4-52_ CCGTTTGGTTCTCTGACTGTCATACTCTTT
DrCMV___OCOM6-2_ CCATTTGGTTCTTTAACTGTGATACTCTTT
RhCMV____U59238_ CCCTTCGGTTCTTTCACTGTGATTCTCTTT
RhCMV____U76749_ CCCTTCGGTTCTTTCACTGTGATTCTCTTT
HCMV______AD169_ CCCTTCGGAGCCTTCACCATCATCCTCGTG